Brd4 Knockout By CRISPR/Cas9 Genomic editing

Doxycycline inducible Cas9 cDNA lentiviral vector (Addgene plasmid #50061 = pCW-Cas9) and additional lentivector constitutively expressing AAVS1-targeting sgRNA (sgCON) (Addgene plasmid #50662 = pLX-sgRNA) or sgBRD4.1 lentivector (pLX-sgRNA vector with AAVS1-sgRNA+PAM_sequence replaced with the following Brd4-targeting sgRNA+PAM_sequence: GTTCAGCTTGACGGCATCCA) were packaged into lentiviral particles that were used to infect, and select for transduced cells. Brd4 sgRNA was designed using E-CRISP software (http://www.e-crisp.org/E-CRISP). For genomic editing, stably infected cells were plated as single cell clones, followed by Cas9 induction for 10 days with doxycycline. Single cell clone outgrowths were expanded, and screened as described previously (59, 60). To determine the efficacy of CRISPR/Cas9 gene editing, genomic DNA was extracted from mouse MPNST cells (parental, sgCON clones 1 and 2, and sgBRD4.1 clones 3, 4, and 13) and the genomic region surrounding the Brd4 sgRNA-targeted sequence was amplified by PCR (Primers used: 5’ – 3’ [F3: CTAACAAGCCCAAGAGACAG, R3: CCAACTTTACCCTTCTGCAG]). The amplified PCR product was submitted for Sanger sequencing by the McDermott Center Sequencing Core Facility at UTSW. The PCR products of sgBRD4.1_Clone 4 and sgBRD4.1_Clone 13 were further sub-cloned into pGEM-T Easy (Promega) cloning plasmids for additional Sanger sequencing via T7 primers. Sequence similarity was assessed using the Basic Local Alignment Search Tool (BLAST) provided by the NCBI.