Cells with selected gene upregulation and downregulation

HEK 293-FT cells were used to produce viruses upon transfection of the packaging plasmids pPAX2 and pMD2 and a pTRIPZ vector containing a tetracycline-inducible promoter driving the expression of a TurboRFP fluorescent reporter (GE Dharmacon technology, provided by Dr Robert Schneider). ShRNAs (Fig. 2b) directed against IFNAR1 (mouse-shRNA: GAGTGACACCTTGCTTGTTTAT), cGAS (Mb21d1, E330016A19Rik) (mouse-shRNA: CAGGATTGAGCTACAAGAATAT; human-shRNA: AAGGAAGGAAATGGTTTCCAAG), STING (Tmem173, 2610307O08Rik, ERIS, MPYS, Mita) (mouse-shRNA: CTCGAAATAACTGCCGCCTCAT; human-shRNA: GGGCACCTGTGTCCTGGAGTAC) Trex1 (mouse-shRNA TGCTCAGCATCTGTCAGTGGAG) or a non-silencing sequence (NS; mouse-human-shRNA: AATTCTCCGAACGTGTCACGT) were cloned into pTRIPZ using EcoRI and XhoI restriction sites. TSA, 4T1, MCA38 and MDA-MB-231 cells were transduced with cell-free virus-containing supernatants and selected with 4 μg ml⁻¹ of puromycin during 48 h. Cells were further submitted to an RFP sorting to establish derivatives with stable expression of the shRNA constructs.

The pTRIPZ plasmid was modified to insert the mouse Trex1 cDNA under the tetracycline-inducible promoter using AgeI and MluI restriction sites (Supplementary Fig. 3b) and used to transduce TSA cells (TSA^{KI Trex1}).