- Home
- Protocols
-
Ask a
question
Prior to sequencing, a reference dataset for taxonomic assignment was compiled from an NCBI search to retrieve sequences corresponding to the species identified in the morphological analysis as well as typical freshwater nematode sequences (Table S2). This avoided uninformative assignments such as “uncultured eukaryote” and “Nematoda environmental sample.” In addition, for each species detected in our study, the number of deposited sequences was noted in order to assess the current status of reference database curation.
Single nematodes frozen in barcoding lysis buffer were thawed, and 1.5 µl of proteinase K (20 mg/ml) was added to each sample, followed by lysis for 70 min at 65°C and 10 min at 95°C. The gene fragments were then amplified using the primer pair 1274/706 (5’–GACCCGTCTTGAAACACGGA‐3’/5’‐GCCAGTTCTGCTTACC‐3‘) designed by Markmann & Tautz (2005) for the D3–D5 region of the LSU (28S gene region hereafter) and the primer pair F04/R22 (5′‐GCTTGTCTCAAAGATTAAGCC‐3′/5′‐GCCTGCTGCCTTCCTTGGA‐3′) designed for the V1–V2 region of the SSU (18S gene region hereafter; Fonseca et al., 2010). PCRs for the 28S gene region were carried out in 20‐µl volumes consisting of 2 µl of genomic DNA, 14.2 µl of ultrapure water, 0.6 µl of each primer (10 µM), 2 µl of reaction buffer Y (Peqlab, Erlangen), 1 µl of dNTPs (Roth, Karlsruhe), and 0.1 µl of Taq‐DNA‐polymerase (Peqlab). PCRs for the other gene region differed by the addition of 2 µl of MgCl2 to each reaction and the use of only 1.5 µl of genomic DNA. PCR conditions were 94°C for 2.5 min, followed by 30 cycles of 30 s at 95°C, 30 s at 55°C, and 60 s at 72°C, a final extension at 72°C for 7 min and cooling at 6°C.
Amplification results were checked by electrophoresis on an agarose gel (2%) and ethidium bromide staining. If the amplification was successful, evidenced by a positive band in the gel, the reaction product was cleaned using ExoSap exonuclease I (20 U/µl; Thermo Fisher Scientific, Waltham, MA) and shrimp alkaline phosphatase (1 U/µl; Affymetrix, Santa Clara, CA) in an 18‐min incubation at 37°C and a 15‐min incubation at 80°C. Sequencing was carried out on ABI PRISM 377, 3,100, and 3,700 sequencers (Applied Biosystems, Weiterstadt, Germany) at the CeBiTec Bielefeld, using BigDye Terminator v3.1 chemistry and the same primer pairs as used for sequencing.
Forward and reverse sequences were merged into contigs with an overlap of at least 20 bp using ChromasPro (Technelysium Pty Ltd, South Brisbane, Australia) and manually checked for ambiguous bases. All sequences of sufficient quality (no N‐characters) were further processed with the RDP classifier (Wang, Garrity, Tiedje, & Cole, 2007). The RDP classifier was trained using the curated reference database (see above). Taxonomic assignments were made based on the lowest level that provided a confidence score of at least 80%. Only classifications at the genus or species level were considered; others were regarded as uncertain. The sequences were collapsed into haplotypes and sorted into OTUs using the R (R Core Team, 2013) package “splits” (http://splits.r-forge.r-project.org/) with the gmyc function. The Jukes–Cantor model was used for both genetic markers, as previously described, and defined by jModelTest (Posada, 2008). New sequences were deposited at the NCBI under the accession numbers MK379606‐MK379948 and MK382985‐MK383328. A detailed overview of the taxonomic assignments for the barcoded specimens is given in (Table S3).
The packages “iNEXT” (Hsieh, Ma, & Chao, 2016) and “fossil” (Vavrek, 2011) in R were used to calculate rarefaction curves with the iNEXT function and to estimate species richness with the jack1 function, for both morphological and barcoding data (Figure S1).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question
