rOma87 Production and Purification

Genomic DNA of A. baumannii was extracted and employed as a template for polymerase chain reaction (PCR). oma87 gene was amplified by the primers: ACTGGATCCATGGATGATTTCGTTGTTAGAGATATTC (forward) and GTACCTCGAGTTAGAAAGTACGACCAATTTCAAACTGAAT (reverse). PCR reaction was performed with pre-denaturation at 94 °C for 3 min followed by 35 thermal cycles of denaturation at 94 °C for 40 s, annealing at 62 °C for 45 s, and final extension at 72 °C for 5 min. Amplified PCR products were analyzed by 1% agarose gel electrophoresis and purified with DNA gel extraction kit (Qiagen). The amplified gene was cloned into pET28a(+) between BamHI and XhoI restriction sites and was transformed to competent cells of E. coli BL21 (DE3) prepared by calcium chloride (CaCl₂) chemical method. The selected clones were confirmed by both PCR and sequencing. The transformed cells were grown in LB supplemented with 70 μg/ml kanamycin at 37 °C with shaking at 150 rpm. Then a single colony from an agar plate was transferred to 1 ml of ZYP-5052 medium [for 100 ml:93 ml ZY (10 g N-Z-amine AS Sigma cat. # N4S 17, 5 g yeast extract, 925 ml water), 0.1 ml 1 M MgSO₄, 2 ml of 50 × 5052 (0.5% glycerol, 0.05% glucose, 0.2% α-lactose), 5 ml 20 × NPS (6.6% of (NH₄)₂SO₄, 13.6% of KH₂PO₄, 14.2% of Na₂HPO₄ in double-distilled water), plus antibiotic in a microtube and shake at 37 °C for 6–8 h. Over-expression of the protein was achieved by transferring 1 ml fresh culture of bacteria to 100 ml ZYP-5052 + kanamycin and then was incubated overnight at 37 °C. After incubation, cooling was carried out on the ice buckets after which the cells were harvested by centrifugation at 2630 rcf for 15 min at 4 °C. The cell pellet was resuspended in buffer B (100 mM NaH₂PO₄, 10 mM Tris–HCl, 8 M urea, pH 8) and then was sonicated (5 times, 15 s, 1 min interval) using a sonicator. The lysate was centrifuged at 17,760 rcf for 20 min at 4 °C to remove the debris. The supernatant was loaded on to the Ni-NTA agarose (Qiagen, Germany) affinity column, pre-equilibrated with the buffer B and cell lysate slowly added (3–4 column volumes per hour) onto the column. The resin was washed twice with washing buffer (100 mM NaH₂PO₄, 10 mM Tris–HCl, 8 M urea and 20 mM imidazole at pH 8), and the recombinant protein was eluted with 5 times 250 µl elution buffer (100 mM NaH₂PO₄, 10 mM Tris–HCl, 8 M urea and 250 mM imidazole at pH 8). The elution fractions were monitored by measuring their absorbance at 280 nm. The purified protein was analyzed by 9% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Refolding of the purified recombinant protein was carried out via sequential dialysis against PBS (pH 7.4) containing 6, 4, 2 and 0 M urea + 0.5 mM l-arginine at 4 °C for 2 h. The purified protein concentration was determined with the Bradford method (Bradford 1976) using bovine serum albumin (BSA) as standard. To validate the recombinant protein expression, western blotting with horseradish peroxidase (HRP)-conjugated anti-polyhistidine antibodies (1:10,000 dilution) was performed in which, 0.493 µg of the recombinant protein was loaded onto the SDS-PAGE.