2.2. DNA Extraction and Helicobacter Pylori Detection

DNA extraction was performed using QIAamp^® DNA Mini Kit (Qiagen, Hilden, Germany, cat. No 51304,) according to the manufacturer’s instructions. H. pylori was diagnosed employing polymerase chain reaction (PCR) using the Hpx1 (CTGGAGARACTAAGYCCTCC) and Hpx2 (GAGGAATACTCATTGCGAAGGCGA) oligonucleotides, under conditions of 40 cycles: 94 °C, 1 min; 59 °C, 1 min, and 72 °C, 1 min. The diagnosis of H. pylori was obtained by electrophoresis, through which a fragment of 150 bp was visualized by agarose gel electrophoresis 2.5%, stained with ethidium bromide, and viewed and photographed in a transilluminator on the α Imager 2200 image capture system (α Innotech Corporation) [27].