Animals

As lengthily described (Cobolli Gigli et al, 2016), the Mecp2 null mouse strain, originally purchased from the Jackson Laboratories, was backcrossed and maintained on a clean CD1 background. These mice recapitulate the typical phenotype of C57BL/6 mice, with the advantage of having a larger progeny and minor risk of litter cannibalization (Cobolli Gigli et al, 2016). Mecp2 null mouse genotype was determined by PCR protocol on genomic DNA purified from tails using the following primers: 5′‐ACCTAGCCTGCCTGTACTTT‐3′ as forward primer for null allele; 5′‐GACTGAAGTTACAGATGGTTGTG‐3′ as forward primer for wild‐type allele; and 5′‐CCACCCTCCAGTTTGGTTTA‐3′ as common reverse primer. Mecp2 ^Y120D/y mouse genotype was assessed using the following primers: 5′‐CAGGGCCTCAGAGACAAGC‐3′ as common forward primer; 5′‐GCAGATCGGCCAGACTTCC‐3′ as common reverse primer; and 5′‐GGGTTAATTGATATCCAATTGGGATCC‐3′ as reverse primer for knock‐in allele. For mouse embryonic fibroblasts (MEFs) and neuronal/astrocytic cultures, wild‐type (WT) and Mecp2 null embryos or pups were generated by mating Mecp2 heterozygous females with WT male mice. The day of vaginal plug was considered E0.5 and primary neurons were prepared from E15.5 embryos, while astrocytic cultures were prepared from post‐natal day 2 (P2) pups. E13.5 embryos were used for MEF preparation. WT and Mecp2 null mice (P7) derived from three separate litters were used to collect cerebella. Mice were rapidly decapitated, brain was removed, cerebellum was isolated and immediately frozen on dry ice and conserved at −80°C until analysis. P7 and P14 WT, Mecp2 null and heterozygous mice derived from three litters were used for immunostaining experiments and confocal analysis.

Animals were housed in a temperature‐ and humidity‐controlled environment in a 12‐h light/12‐h dark cycle with food and water ad libitum. All procedures were performed in accordance with the European Union Communities Council Directive (2010/63/EU) and Italian laws (D.L.26/2014). Protocols were approved by the Italian Minister for Scientific Research and by the San Raffaele Scientific Institutional Animal Care and Use Committee in accordance with the Italian law.