Improve Research Reproducibility A Bio-protocol resource
- Home
- Protocols
-
Concise Method
2.8. Quantitative Real-Time PCR Analysis
Ask a
question
Favorite
The total mRNA of cells was extracted using TRIzol (Thermo, USA) and cDNA was synthesized from 2 μg of total RNA using an RT kit (Thermo, USA) following the manufacturer's instructions. The mRNA quantity of Mdm2 gene was assessed by quantitative real-time PCR (ABI, USA). The primers used for amplification are as follows: β-actin F, CCCATCTATGAGGGTTACGC; β-actin R, TTTAATGTCACGCACGATTTC; Mdm2 F, TTGATGATGGCGTAAGTGA; Mdm2 R, AGGCTGTAATCTTCTGAGTC.
Copyright and License information: ©2016 Hong Chang et al.
This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question0 Q&A
