2.7. RNA quantification via Real‐time quantitative PCR (real‐time qPCR)

Total RNAs were isolated and reversely transcribed into cDNAs via a specific adaptor primers for miR‐126a‐5p (5’ GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCGCGTA3’) and the control 5s (homo: 5’ GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAAGCCTAC3’; mus: GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTAGCCTTGC3’) for detection the expression of miR‐126a‐5p. For other genes, RNAs were processed into cDNA in presence of oligo (dT)₁₅ and random primers. We carried the reverse transcription experiments by using Taq PCR MasterMix (BioTeke Bio). RNA expression was quantitatively analysed using SYBR Green miRNA assays (Sigma‐Aldrich) as per the manufacturer's protocols. Primers used in real‐time qPCR were listed in table ​table1.1. The relative expression levels were presented as 2^{−ΔΔ C t}.

Primers