Generation of CRISPR/Cas9 knockout cell lines

Knock-out HeLa cells lines were generated using the Alt-R CRISPR-Cas9 System (Integrated DNA Technologies, IDT), by using a mix of a sequence-specific CRISPR RNA (crRNA), a conserved, transactivating crRNA (tracrRNA) and recombinant Alt-R S. pyogenes Cas9 (IDT). crRNA and tracrRNA were mixed to 1 µM, heated 5 min at 95 °C and cooled to room temperature. 1 µM Alt-R Cas9 was mixed and incubated at room temperature for 5 min. Lipofectamine RNAiMax transfection reagent (Invitrogen) was then added and the mixture was incubated for 20 min at room temperature. 40,000 cells/well were reversely transfected with the previous mixture in 96-well plates, to achieve a concentration of 10 nM ribonucleoprotein complex. After incubation for 2 days at 37 °C, 5% CO₂, single clones were generated by serial dilutions and the desired gene knockouts were screened by performing the T7 endonuclease I assay, verified by sequencing of the PCR fragments and confirmed by western blotting. The following crRNAs were used: AGGGATTCCAACACCTTAAG (for CASP4), CCACGTACACGTTGTCCCCG (for GSDMD) and GAACACTAATGGGCGACTGA (for GBP1).