2.4. Quantification of mitochondrial DNA copy

Total DNA was extracted using DNeasy Blood & Tissue kit (69504, Qiagen) following to the manufacturer's instruction. The number of mitochondrial DNA copies (ND1‐mtDNA, mitochondria‐specific DNA) in H9C2 cells was quantified by real‐time qPCR using QuantiNOVA SYBR Green PCR assay (208054, Qiagen) and normalized by rat genomic DNA (GAPDH‐DNA, intronic DNA). Triplicate assays were performed on Step One‐Plus (Applied Biosystems). Primer sequences were listed below: ND1‐mtDNA forward: 5’‐CTCCCTATTCGGAGCCCTAC‐3’; ND1‐mtDNA reverse: 5’‐ATTTGTTTCTGCTAGGGTTG‐3’ 12 ; GAPDH‐DNA forward: 5’‐ GTTACCAGGGCTGCCTTCTC −3’; GAPDH‐DNA reverse: 5’‐ GGGTTTCCCGTTGATGACC −3’; ANP forward: 5’‐ CTGCTAGACCACCTGGAGGA‐3’; ANP reverse: 5’‐ AAGCTGTTGCAGCCTAGTCC‐3’. 13