2.7. Quantitative RT‐PCR (qRT‐PCR) for pluripotency gene expression analysis

RNA extraction was carried out using TRIzol™ (Thermo Fisher Scientific) with slight modifications from the manufacturer's instructions. Briefly, cells/spheroids were washed twice with 1 mL PBS after harvest. TRIzol™ (400 µL) was added to the cells and the solution was pipetted up and down vigorously several times to homogenize the cells. The solution was then heated at 55°C for 10 minutes and later vortexed for 5 seconds (done twice to ensure maximum cell lysis). The cell lysate in TRIzol™ were transferred to Phasemaker™ tubes (Thermo Fisher Scientific), and 80 µL chloroform (Fisher Scientific) was added to the solution (200 µL chloroform per 1 mL TRIzol™ used). The mixture was vortexed for 30 seconds, and allowed to incubate at RT for 20 minutes. The mixture was then centrifuged at 15 000 g for 15 minutes at 4°C. After centrifugation, the clear aqueous phase (RNA‐containing fraction) was aspirated out and transferred to an RNase‐free tube. Isopropanol (200 µL, Fisher Scientific) was added to this aqueous phase (500 µL chloroform per 1 mL TRIzol™ used), and the mixture was inverted up and down for ~30 times and left to incubate at RT for 10 minutes. This mixture was then centrifuged at 15 000 g for 15 minutes at 4°C. The supernatant was carefully pipetted out and the pellet was resuspended in 75% ethanol (Sigma‐Aldrich). The solution was then vortexed for 10 seconds and centrifuged at 7500 g for 5 minutes at 4°C. The supernatant was carefully pipetted out and the pellet was left to air‐dry. Once dry, the pellet was resuspended in 35 µL of TE buffer (Sigma‐Aldrich). RNA concentrations were measured using NanoDrop™, alongside the quality (ie, the A_260nm/A_280nm ratio). Only RNA samples with A_260nm/A_280nm ratio ≥1.5 were used for cDNA synthesis and PCR/qRT‐PCR experiments. RNA stocks were stored at −80°C until use.

cDNA synthesis was performed using the QuantiTect^® Reverse Transcription kit (Qiagen), following the instructions provided by the supplier. Equal amounts of RNA (160 ng) from each cell clone were used for the cDNA synthesis. It was assumed that the amount of cDNA produced at the end of the reaction is equal to the amount of RNA used for the reaction. The reverse transcription products were then made up with nuclease‐free water to obtain 5 ng/µL cDNA stocks and stored at −20°C until use.

Primers for all housekeeping and target genes were designed using the Primer‐BLAST online tool (NIH, USA – https://www.ncbi.nlm.nih.gov/tools/primer‐blast/), and the exon template sequence for each gene were obtained from the NCBI Gene database (NIH, USA – https://www.ncbi.nlm.nih.gov/gene). Primers were designed using the following criteria: (a) Primers must span an exon‐exon junction, (b) Range of target PCR product falls within 7‐250 base pairs (bp), (c) Range of primer melting temperatures (T_m) fall within 60 ± 3°C, (d) Minimum of seven and five nucleotides present at 5′ and 3′ end of exon, respectively, (e) At least one of the last two nucleotides at the 3′ end of the designed primer ends with C/G, (f) The ΔG value for the homodimer (of each primer of the pair) and heterodimer tendency of the primers are > −6 kcal/mol, and (g) The G/C content of each primer is ≤60%. Thermodynamic parameters of the primers were analyzed using the OligoAnalyzer online tool (IDT – https://www.idtdna.com/calc/analyzer), with “qPCR” chosen for the “Parameters set” option. Sequences of primers used are as follows: GAPDH, forward, 5′‑TGTTCCAATATGATTCCACCCA‑3′, reverse 5′‑CAAATGAGCCCCAGCCTTC‑3′; 18S rRNA, forward, 5′‑GTTGAACCCCATTCGTGATG‑3′, reverse, 5′‑CCATCCAATCGGTAGTAGCG‑3′; Oct4A, forward, 5′‑CTTCGCAAGCCCTCATTTCACC‑3′, reverse, 5′‑CCAGGTCCGAGGATCAACC‑3′; Nanog, forward, 5′‑CTGATTCTTCCACCAGTCCC‑3′, reverse, 5′‑AGGTCTTCACCTGTTTGTAG‑3′. All primers were purchased from IDT (Leuven, Belgium), reconstituted in TE buffer to obtain 10 µmol/L stocks upon arrival and stored at −20°C until use.

The qRT‐PCR reaction mixture was prepared to contain 1X SsoAdvanced™ SYBR^® Green Supermix (Bio‐Rad), 500 nmol/L forward and reverse primers, 10 ng cDNA and made up to 20 µL total reaction volume with nuclease‐free water. All components were kept on ice after thawing, and the reaction mix preparation was done in a 96‐well PCR plate placed on cold blocks (three replicates per condition). The PCR plate was sealed with a clear adhesive film and centrifuged briefly to ensure all liquid was collected at the bottom of each well. The plate was then placed in the ABI 7500 Real‐Time PCR System (Thermo Fisher Scientific), and the reaction was run according to the cycling conditions: initial denaturation—95°C, 60 seconds; amplification (40 cycles)—95°C, 15 seconds and 65°C (annealing temperature), 60 seconds; melt curve analysis—instrument default settings. Ct values of each of the housekeeping and target genes were obtained using the 7500 software v2.3 (Thermo Fisher Scientific). The relative expression levels of each target gene in all the cDNA tested were calculated using the 2^−ΔΔCt method, using Ct values from hiPSC as the reference.