Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Knockdown of HIF-1α by small interfering RNA (siRNA)

YH Yan Huang
FT Fengbo Tan
YZ Yi Zhuo
JL Jianyang Liu
JH Jialin He
DD Da Duan
ML Ming Lu
ZH Zhiping Hu
ask Ask a question
Favorite

The siRNA knockdown of HIF-1α expression, the following siRNA target sequences of HIF-1αwere used: CCCATTCCTCATCCGTCAAAT. These are primer sequence were selected for mRNA quantification: forward; TCCAGCAGACCCAGTTACAGA, and reverse; GCCACTGTATGCTGATGCCTT. The forward sequence of Actin was: ACATCCGTAAAGACCTCTATGCC, and the reverse sequence of Actin was: TACTCCTGCTTGCTGATCCAC. The expression of HIF-1α in OM-MSCs was silenced using siRNA transfection kit according to the manufacturer's instructions (Ribobio, China). The efficiency of HIF-1α knock-down in OM-MSCs was verified by Western blotting and qPCR assays.

Copyright and License information:  ©2020 Huang et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A