Isolation of Halophilic Microorganisms

For our preliminary analysis of detecting culturable halophiles in samples, we used the standard dilution-plating method to count and isolate cultivable microorganisms in salt and brine samples. A series of dilutions (using sterile 1.5 M NaCl solution) was prepared for each sample from the stock suspension, 1 g salt, and l mL brine in 99 mL of 1.5 M NaCl solution. Aliquots, 0.1 mL, from various dilutions (10^–1 to 10^–4) were spread on the surfaces of plates containing the solid Nutrient Broth medium (NA) composed of (in grams per liter) (pH 7.0, peptone 5, yeast extract 3, and NaCl (4, 16, and 25%). Solid media were amended with 2% agar. We used the NA medium for the isolation of halophilic bacteria. For haloarchaea, the mineral constituents of the specific medium CM+ have the following composition in (g/L); NaCl: 250, Magnesium Sulfate: 20, (Tri) Sodium Citrate: 3, Bacteriological peptone: 10, Trace metals: 0.1. To solidify the media, 2% agar was added, and the medium pH was adjusted to 7.2. The plates were sealed and incubated at 37°C for 10 days to 2 weeks. Three replicate plates were prepared for each dilution. The total colony numbers were counted, and colony-forming units (CFU) per gram of sample were calculated. Three replicate plates of dilutions containing countable numbers of colonies (100–200) were pooled. Identical colonies (colony shapes, sizes, colors, margins, texture, etc. and cell shapes and sizes as well as the cell Gram stain reaction) were counted, their proportions of the total CFU were calculated, and five replicate representatives were sub-cultured, purified and maintained for further study. For the molecular characterization of the isolates, the genomic DNA was extracted using the ethanol precipitation method (Delbès et al., 2000) with slight modification (Leena et al., 2018). The genomic DNA is confirmed by gel electrophoresis by running it on 1% gel in 0.5 × TBE buffer. Gel images were observed by Bio-Rad gel documentation system. DNA. The 16S rRNA genes in the total genomic DNAs were amplified by polymerase chain reaction (PCR) using the universal primer combination 8F: 5′AGAGTTTGATCCTGGCTCAG and 1492R: 5′AAGTCGTAACAAGGTAACC for bacteria and 4F: 5′TCCG GTTGATCCTGCC and 1492R: 5′AAGTCGTAACAAGGTAA CC for Archaea. Approximately, 5–10 ng of NanoDrop quantified DNA was used for amplifying the entire 16S rRNA with universal primers. The PCR reaction was carried out with PCR mixtures (25 μL) containing 25 pmol of each primer, 1 μL of 100% DMSO, 0.25 μL of 10 mM dNTPs, 0.25 μL of Taq polymerase, 2.5 μL of 10x buffer and 2 μL of the DNA template. The PCR program consisted of an initial denaturation step at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, primer annealing at 55°C for 45 s, and extension at 72°C for 2 min, followed by a final 5 min elongation step at 72°C. Partial sequencing of the 16S rRNA genes was performed using the 3130 XL Genetic Analyzer (BASLab Baltimore, MD, United States). Sequences were subjected to a basic local alignment search tool analysis (BLAST) with the National Center for Biotechnology Information (NCBI) GenBank database. Sequenced 16S rRNA genes data was assembled manually after checking for quality assurance utilizing BioEdit software version 7.3.5. (Hall et al., 2011).