PCR and sequencing methods

Dual sgRNA cassettes were PCR-amplified and barcoded with sequencing adaptors using Ex Taq polymerase except where otherwise specified. When we tested alternative polymerases, we also used LA Taq HS, KOD HS, Herculase HS, Q5 and PfuUltra Fusion polymerase kits following manufacturer recommendations for PCR amplification conditions (Table 2). For kits that did not provide dNTPs, the suggested concentration of dNTPs was added using the 2.5 mM per dNTP stock provided in Takara’s Ex Taq kit.

All volumes are calculated for one 100 μL volume reaction.

P5/P7 primers were synthesized at Integrated DNA Technologies (IDT):

Forward (P5) 5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA TCT[s]TTGTGGAAAGGACGAAAC*A*C*C*G

Reverse (P7) 5’CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGT GCTCTTCCGATCTCCAATTCCCACTCCTTTCAA*G*A*C*C

P5/P7 flow-cell attachment sequence

Illumina sequencing primer

[Stagger region]

Barcode region

Vector primer binding sequence

* between bases indicate phosphorothioate linkages

PCR cycling conditions:

1 minute at 95°C

30 seconds at 94°C, 30 seconds at 52.5°C, 30 seconds at 72 °C, for n cycles

10 minutes extension at 72 °C.

Following PCR, samples were purified with Agencourt AMPure XP SPRI beads (Beckman Coulter A63880) according to manufacturer’s instructions. In cases where gel images following PCR suggested a wide range of DNA yield per well, wells with similar band strengths were purified together in sub-pools. Each purified sub-pool was quantitated with UV spectroscopy (Nanodrop) and pooled into a master sequencing pool such that each PCR well contributed approximately equally to the final master pool. The master pools were sequenced on a MiSeq sequencer (Illumina) with 300 nt single-end reads, loaded with a 5% spike-in of PhiX DNA.