Reverse transcription probe based real time PCR

Roche Real Time Ready RNA Virus Master Kit (Roche, Indianapolis, IN) was used on RNA extracted from serum-cell supernatants, serum, urine and tissue to assay for ZIKV RNA according to manufacturers’ instructions. Primers used were ZIKV 1086 (CCGCTGCCCAACACAAG) and ZIKV 1162c (CCACTAACGTTCTTTTGCAGACAT). Probe was ZIKV 1107-FAM (AGCCTACCTTGACAAGCAGTCAGACACTCAA) [55]. Two-hundred nanograms of sample RNA was added to each reaction. Reactions were performed in duplicate. Standards were a non-infectious clone of full length ZIKV strain PRVABC59 by which concentration was determined through optical density. Molecular weight of the genome sequence was used to calculate copy number [56]. A log₁₀ dilution series of the standard was made and linear regression used to determine copy number equivalents of positive samples. Amplification was performed according to manufacturers’ protocol for Roche Real Time Ready RNA Virus Master Kit (Roche Diagnostics Corporation, Indianapolis, IN) with PCR conditions as follows: 8 min at 50°C, 30 s at 95°C, and 45 cycles of 10 s at 95°C, 20 s at 60°C and 10 s at 72°C.