Southern Blot Analysis of the Col1A1 Locus

Genomic DNA was isolated from ES cell clones, digested with EcoRI, and fractionated on a 0.8% TBE agarose gel (Sambrook and Russell 2001). After transfer to Hybond N+ membranes, the DNA was interrogated using a probe targeting the hygromycin gene outside of the region targeted by the donor template. The probe was generated by PCR amplification using primers A (^5′ATGAAAAAGCCTGAACTCACCG^3′) and B (^5′CCAATGTCAAGCACTTCCG^3′) and labeled using ThermoFisher DecaLabel DNA Labeling Kit (K0662) with α-³²P-dCTP (New England Nuclear, MA). Following hybridization, membranes were washed in 2x SSC/0.1% SDS once at 25°, twice at 55°, and then once with 1x SSC/0.1% SDS at 55°.