Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The PCR primers were designed based on the human SS mRNA sequences from GenBank, and GAPDH was used as a control. The primers were synthesized by Nanjing GenScript Biotechnical Co., Ltd (Nanjing, China) and had the following sequences (in 5′-3′ direction): SS upstream, GCTGCTGTCTGAACCC and downstream, CGTTCTCGGGGTGCCATAG (product length, 138 bp); GAPDH upstream, TGCACCACCAACTGC and downstream, GGCATGGACTGTGGTCATGAG (product length, 87 bp). Total RNA was extracted using TRIZOL reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. A cDNA Reverse Transcription lit (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used for reverse transcription. Briefly, 3 µg total RNA (0.5 µg/µl), 1 µl Oligo dT Primer, 1 µl dNTP Mixture (both Takara Biotechnology Co., Ltd., Dalian, China) and RNase-free doubly distilled (dd)H₂O (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) were mixed with the total mixture of 10 µl. The mixture was stirred at 70°C for 5 min and then the 10 µl mixture, 4 µl 5X PrimeScript II Buffer, 0.5 µl RNase inhibitor, 1 µl PrimeScript II RTase and 4.5 µl RNase-free ddH₂O were mixed followed by a reaction at 45°C for 45 min and 95°C for 5 min. PCR was performed on a Mastercycler^® RealPlex² thermal cycler (Eppendorf, Hamburg, Germany) and data were analyzed by MxPro software (version 4.0; (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA). The reaction system (18 µl) comprised diethyl pyrocarbonate-treated H₂O (3.6 µl), 1.2 µl of a 10-µM solution of each primer, 10 µl SYBR^® Green Realtime PCR Master Mix and 2 µl complementary DNA. Each condition was performed in 3 parallel wells. The following thermocycling program was used: 95°C for 10 min, followed by 42 cycles of 95°C for 30 sec and 58°C for 20 sec, and 72°C for 30 sec. Following determination of the ΔCq value, the relative expression level of the target mRNA was calculated. Using GAPDH as an internal reference, the relative changes in gene expression were calculated as 2^−ΔΔCq (15).