Quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR)

Isolation of total RNA, generation of cDNA and RT-PCR analysis were performed as previously described [18]. The sequences of the specific primers were as follows: IL-6 (forward, 5′- CCAGGAGCCCAGCTATGAA -3′; reverse, 5′-TTCTGCCAGTGCCTC TTTG -3′), TGF-β (forward, 5′-TACCTGAACCCGTGTTG CTC -3′; reverse, 5′-CCGGTAGTGAACCCGTTGAT -3′), ACTA2 (forward, 5′- ATTGCCGACCGAA TGCAGA -3′; reverse, 5′- ATGGAGCCACCGATCC AGAC -3′), MMP1 (forward, 5′-CTCTGGAGTAATGTCACACCTCT -3′; reverse, 5′-TGTTGGTCCACCTTTCATC TTC -3′), col1A1 (forward, 5′- CCCGGGTTTCAGAG ACAACTTC -3′; reverse, 5′- TCCACATGCTTTATTCCAGCAATC -3′), MMP-2 (forward, 5’- GATACCCCTTTGA CGGTAAGGA -3’; reverse, 5’- CCTTCTCCCAAGG TCCATAGC -3’), MMP-9 (forward, 5’- TGTACCGCTATGGTTACACTCG-3’; reverse, 5’- GGCAGGGACAGTTGCTTCT-3’) and 18S (forward, 5′- GTAACCCGTTGAACCCCATT-3′; reverse, 5′- CCATCCAATCGGTAG TAGCG-3′). PCR consisted of an initial cycle of 95°C for 30 sec and then 40 cycles, each consisting of denaturation at 95°C for 5 sec, followed by annealing and primer extension at 60°C for 30 sec. Melting curve analysis was conducted from 60°C to 95°C, with a heating rate of 0.3°C per sec. The abundance of each gene was determined relative to that of the 18S transcript.