2.7. RNA Extraction and RT-qPCR Analysis

The reverse transcription-qPCR (RT-qPCR) was performed to ascertain the yak DGAT2 expression in tissues using yak β-actin as an internal control. Two pairs of qPCR primers were designed to amplify a 149-bp fragment of yak DGAT2 and a 133-bp fragment of β-actin based on the mRNA sequences (GenBank Accession Nos. {"type":"entrez-nucleotide","attrs":{"text":"XM_005902498","term_id":"942075003","term_text":"XM_005902498"}}XM_005902498 and {"type":"entrez-nucleotide","attrs":{"text":"DQ838049.1","term_id":"111143488","term_text":"DQ838049.1"}}DQ838049.1, respectively). The DGAT2 qPCR primers were 5’-GGCCTCTTCTCCTCTGACACC-3’ and 5’-CACCAGGGCTTGCACGTACA-3’, and the β-actin primers were 5’-AGCCTTCCTTCCTGGGCATGGA -3’ and 5’- GGACAGCACCGTGTTGGCGTAGA -3’. Total RNA was extracted from tissue samples of yak using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The integrity and concentration of total RNA was assessed by 2% agarose gels in electrophoresis and UV spectrophotometry. The cDNA was synthesized by reverse transcription from total RNA using the PrimeScript^TM RT Reagent Kit with the gDNA Eraser (Takara) following the manufacturer’s instructions. The amplification of the cDNA was conducted in 20-μL reaction mixture consisting of 100 ng cDNA, 0.25 μM of each primer, 10.0 μL AceQ qPCR SYBR^® Green Master Mix (Vazyme, Nanjing, China), 0.4 μL ROX Reference Dye 2, and supplemented with ddH₂O to a volume of 20 μL. The thermal profiles were one cycle of 5 min at 95 °C, followed by 40 PCR cycles of 10 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. The 2^−ΔΔC_T method was used to analyze the relative expression data [28]. Amplification was performed in Applied Biosystems Quant Studio^®6 Flexq (Applied Biosystems, Carlsbad, CA, USA).