Preparation of KO cells

STX17- and VAMP8-KO MEF and SEC62-KO HEK cells were generated by CRISPR/Cas9 genome editing. For the generation of the guideRNA‐Cas9 plasmids, lentiCRISPRv2‐puro system (Addgene52961) was obtained from Addgene (http://www.addgene.org). Guide sequences were obtained from the Cas9 target design tools (crispr.mit.edu:8079 and/or www.addgene.org/pooled-library). All protocols and information can be found at the website https://www.addgene.org/crispr. The target sequences for guide RNA were synthesized by Microsynth. Two annealed oligonucleotides (5′-CACCGCTGTGGTTGACTACTGCAAC-3′, 5′-AAACGTTGCAGTAGTCAACCACAGC-3′ for human SEC62; 5′‐GCGCTCCAATATCCGAGAAA‐3′, 5′‐TTTCTCGGATATTGGAGCGC‐3′ for murine STX17; 5′‐CCACCTCCGAAACAAGACAG‐3′, 5′‐CTGTCTTGTTTCGGAGGTGG‐3′ for murine VAMP8) were inserted into the lentiCRISPRv2‐puro vector using the BsmBI restriction site. Vectors were transfected in HEK and MEF cells with JetPrime (Polyplus) according to the manufacturer’s instructions^7,19. Cells were cultured in DMEM supplemented with 10% FBS. Two days after transfection, the medium was supplemented with 2 μg/ml puromycin. After 10 days, puromycin‐resistant clones were picked and gene KO was verified by WB (ref. ⁷ for SEC62; Fig. 3a, b and ref. ¹⁹ for STX17 and VAMP8) and with a translocation assay for SEC62 (ref. ⁷ and Supplementary Fig. ^3c).