4C-sequencing

4C templates were prepared as previously described⁶⁴. In short, snap frozen adult mouse hearts of Scn5a RE6-9 mutant mice and wildtype littermates were crushed, dissociated and dounce homogenized to obtain single cell suspension. Chromatin was cross-linked with 2% formaldehyde in PBS with 10% FCS for 10 min at room temperature. Nuclei were isolated and cross-linked DNA was digested with DpnII, followed by proximity ligation. Cross-links were removed and a secondary restriction digestion with Csp6I performed, followed again by proximity ligation. Per viewpoint, 8 PCR reactions were performed on 200 ng of 4C template each, to a total of 1.6 µg. PCR reactions were pooled and purified for next generation sequencing. The 4C-seq PCRs were essentially performed as previously described⁶⁴ using reading primers (Scn5a_P1 + 2—GTCCCAAGGGCACACTGATC and Scn5a_enh1—GAGACCCACACGTTAGGATC) as 4C viewpoints combined with non-reading primers (Scn5a_P1 + 2—CCTCTAGAGAGCCTAGTCCC and Scn5a_enh1—ACGGTGAGGACAACATAGAC). The primers were extended with Illumina adapter sequences. Sequencing reads were demultiplexed and subsequently trimmed using FourCSeq package python tool “demultiplex.py“⁶⁵. Trimmed reads were aligned with bowtie2 (v2.2.5) using standard parameters and quality filter set to 1 (-q 1) and processed as described in⁶⁴. In short, reads are mapped to a restricted mouse reference genome (mm9) consisting of sequences directly flanking the 4C primary restriction enzyme sites (DpnII), termed 4C frag-ends. Non-unique frag-ends are discarded for posterior analysis. The frag-end with highest coverage is removed from the dataset in the normalization process and data are read-depth normalized to 1 million aligned intrachromosomal reads. 4C-Seq coverage profile is obtained using “running means”, i.e. coverage averages of 21 consecutive 4C frag-ends.