Construction of expression vectors and transfection

For generating stably transfected A375 cells, human cDNA of S100A4 was cloned into the mammalian expression vector pIRES2‐AcGFP1 (Clontech, Saint‐Germain‐en‐Laye, France). Briefly, the coding region of S100A4 was amplified by PCR using a 5′ oligonucleotide primer: 5′‐CCTTCTGCAGGCTGTCAT‐3′, containing PstI site (underlined) and a 3′ primer: 5′‐CATCAGAGGATCCTTCATTT‐3′, containing BamHI site (underlined). The amplified DNA was cut with restriction enzymes and ligated into the PstI and BamHI cloning sites of pIRES2‐AcGFP1. The pIRES2‐AcGFP1‐hS100A4 plasmid construct was purified with a plasmid isolation kit (5 Prime, Hamburg, Germany), and transfected into A375 cells using Lipofectamine^™ (Invitrogen, Darmstadt, Germany) according to manufacturer's instructions. Transfectants, termed as A375‐hS100A4, were selected in medium supplemented with 1.2 mg/ml G418 (Biochrom, Berlin, Germany). Transfected and wild‐type A375 cells used in this study were characterized by DNA profiling (Cell Line DNA Typing Report; DDC Medical, London, UK).