Generation of Myo7a-ΔC, Myo7a full KO, and HA-Myo7a-C mice

For CRISPR/Cas mediated generation of the mouse models, we used the online tool CRISPOR (http://crispor.tefor.net/crispor.py)⁶⁷ to select suitable target sequences to ablate the Myo7a-C isoform (AAGCATGGTTATTCTGCAGA, in exon 2). The same target was used for generating the HA-Myo7a-C mouse strain. Sequence of the repair template: GCCTGGGCTCAGGGCGTGCCATGGTCTCTTCCCACAGAGCTGTGTCTGGTCACTCCGGCAGGTGTGCTGACGTAGAAGCATGTACCCATACGATGTTCCAGATTACGCTGTTATTCTGCAAAAGGTGAGTGCGTCTCCTCTCTCTCAGAGCTGCAGAGGGCCATGCTGGGTACCTCACATCCCACCCTGCA (HA-coding sequence in bold, flanked by mouse Myo7a locus-specific homology arms). For generating the Myo7a full KO mouse, the target CCTCCTCGTCTTCATCAGGC in exon 24 was used. To generate the corresponding single-guide (sg)RNAs, a PCR product from overlapping oligonucleotides (as described in the CRISPR online tool) was generated by T7 in vitro transcription. Oligonucleotide sequences: for Myo7a-ΔC: forward primer: GAAATTAATACGACTCACTATAGAAGCATGGTTATTCTGCAGAGT TTTAGAGCTAGAAATAGCAAG and universal reverse primer: AAAAGCACCGAC TCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC, and for Myo7a full KO: forward primer: GAAATTAATACGACT CACTATAGCCTCCTCGTCTTCATCAGGCGTTTTAGAGCTAGAAATAGCAAG and universal reverse primer. In vitro transcription was performed using the MAXIscript T7 kit (Life Technologies) and RNA was purified using the MEGAclear kit (Thermo Fisher Scientific, Waltham, MA). For production of genetically engineered mice, fertilized eggs were coinjected with Cas9 protein (PNA Bio, 50 ng/μl) and the sgRNA (30 ng/μl). Two-cell stage embryos were implanted on the following day into the oviducts of pseudopregnant ICR female mice (Envigo). Genotyping was performed by PCR amplification of the region of interest (Myo7a-ΔC forward primer: CTGAAGACTAAGTAGGAGTTTG; Myo7a-ΔC reverse primer: TAGACTGAGCTTTAATCAGAAG, Myo7a full KO forward primer: CCAGCCTAACGGTT AAGACA; Myo7a full KO reverse primer: AGCTGGTCACCCTCATCGT), followed by Sanger sequencing. Founder mice were selected. The Myo7a-ΔC mouse harbors a reading frame-shifting 1-bp insertion in exon 2. The Myo7a full KO founder harbors a 26-nucleotide deletion in exon 24 (deleted sequence: CCTGCCTGATGAAGACGAGGAGGACC). Myo7a-ΔC mice were genotyped by Sanger sequencing, and Myo7a full KO mice by gelelectrophoretic size analysis (WT band 244 bps, KO band 218 bps).