Zebrafish expression constructs, CRISPR and morpholinos

CMV:vegfaa- pCS2(+)-zvegf₁₆₅ was a gift from Dr. Ruowen Ge (National University of Singapore). CMV promoter-driven zebrafish vegf₁₆₅ DNA for injection was generated as previously described. DNA was injected at a final concentration of 75 ng/μL. Zebrafish pCR-plcg1 was MluI digested and pCSDest-pik3cd or pik3c2b was ClaI digested for 1 hour prior to DNA injection at the single cell stage at 75–100 ng/μL.

Morpholino antisense oligonucleotides (Genetools) used in this study include:

cds2 ATG MO: 5′-TCGCTGTCGTAATTCTGTCATGGTG-3′ that targets −4 to 21 of the 5′ untranslated region and coding region of cds2 (1.8 ng was used as a maximal dose);

vegfaa: 5′-CTCGTCTTATTTCCGTGACTGTTTT-3′ (6 ng was used as a maximal dose). The cds2 and vegfaa morpholinos used have both been previously validated^16,56. Morpholino injections were performed on zebrafish embryos in the 1– cell stage as previously described in ref. ². Maximal doses were determined by titration of morpholinos to levels that yielded maximal vascular-specific phenotypes with little to no nonspecific toxic effects.

PI4K inhibitor (PIK-93, #B-0306, Echelon Biosciences) was resuspended in DMSO and used on the zebrafish at 20-40 uM.

The impa2 ^y602 mutant allele was generated using the CRISPR/Cas9 system. The following guide RNAs were transcribed in vitro using the MEGAscript T7 Kit (Invitrogen), and injected at a dose of 150 pg/nl per embryo:

TAATACGACTCACTATAGGGCGTCAGGTTTATTGGTGGTTTTAGAGCTAGAA.

pT3TS-nCas9 (Addgene) was transcribed using MEGAscript T7 Kit (Invitrogen), and injected at a dose of 300 pg/nl per embryo. Embryos were injected at the single cell stage, screened for cutting efficiency and grown on system. F1 generations were analyzed for mutations, and pairs crossed for analysis in the F2 and beyond generations.

ABI 3130xl Fragment Analyzer Protocol for Genotyping impa2 ^y602 mutants.

PCR protocol with AmpliTaq Gold DNA Polymerase 1×(10 μl) Rxn: 1 μl 10x PCR Gold Buffer; 0.5μl MgCl₂ 25 mM; 1 μl 0.5 mM ABI Fwd primer; 1 μl 1 mM ABI Rev primer; 0.2 μl 10 mM FAM-M13 primer; 0.1 μl dNTP Master Mix; 0.1 μl TaqGold polymerase; 1 μl of 1:10 diluted crude gDNA; 5.1ul H2O.

TaqGold PCR Program: 95 °C 10 min; 95 °C 30 s; 58 °C 30 s; 72 °C 30 s (1 min/kb); GoTo Step 2 x34; 72 °C 10 min; 15 °C Hold; Run on ABI immediately or store at 4 °C in the dark for 24 h max.

ABI 3130xl Pate set-up: HiDi Formamide/ROX master mix- 0.2 μl ROX300HD; 9.8 μl HiDi Formamide; add 10 μl of master mix to each ABI plate sample well; add 2 μl of fluorescent PCR product; cap wells and denature at 95 °C for 5 min; uncap all wells and replace with ABI plate septa to run on the 3130xl. Follow manufacturer directions to utilize the ABI 3130xl.

Gene Specific primers for genotyping:

impa2:

FW-M13: TGTAAAACGACGGCCAGTCTTACTGTGACATGTTAATGTGATG

RV-PIG Tail: GTGTCTTGCACAAAGTTACAGGTGCCGTCGATG

FAM-M13: 5′-/56-FAM/ TGTAAAACGACGGCCAGT-3′.