Real time quantitative PCR (RT-qPCR)

The RT-qPCR was applied using the commercial SYBR Green PCR Kit (Qiagen, Shanghai, China) and the designed primers. The primers for quantifying SPC25 are 5'‑AGAAGAACGAATGGTTGAGAT‑3' (forward) and 5'‑TCCTGGATATTTGCAGTCAGT‑3' (reverse); The primers for quantifying β-actin: 5’-CTCTTCCAGCCTTCCTTCCT-3’ (forward) and 5’-AGCACTGTGTTGGCGTACAG-3’ (reverse). The RT-qPCR reactions were performed in duplicate. The levels of gene expression were quantified with the 2-△△Ct method and normalized sequentially with β-actin and the experimental controls.