Site‐directed mutagenesis of predicted ER‐binding sites

QuickChange^® II site‐directed mutagenesis kit (Agilent Technologies) was used to insert point mutations into predicted binding sites to subsequently prevent transcription factor binding. The online tool MAPPER (http://bio.chip.org/mapper) was used to verify destruction of the predicted binding site. Constructs harboring more than one mutation were generated by consecutive rounds of mutagenesis. Primers for mutation insertion (Table ​(Table5)5) were designed with the online tool QuickChange^® Primer Design (https://www.genomics.agilent.com/primerDesignProgram.jsp) against predicted ERα binding sited in OAT1 promoter. Mutagenesis was performed according to manufacturer’s recommendation and the product of the mutagenesis‐PCR was transformed into XL1‐Blue supercompetent cells. After overnight incubation of plated XL1‐Blue supercompetent cells, three clones were picked and a miniprep with QIAprep^® Spin Miniprep Kit (Qiagen) was performed followed by sequencing to ensure successful mutation. Clones harboring the new mutations were amplified as described in Plasmid amplification. Sequencing was performed with BigDye^® terminator v1.1 cycle sequencing kit (Thermo Fisher) to verify plasmid mutation. For sequencing a forward and reverse primer starting in the pGL3‐Enhancer sequence neighboring the insert was used: forward 5’‐ CTGTGTGTTGGTTTTTTGTGTG −3’, reverse 5’‐ TCTCCAGCGGTTCCATCTTC −3’. The PCR reaction was set up in 10 µL with 0.5 µL BigDye^®, 2 µL sequencing buffer, 350–400 ng plasmid and 10 pmol primer and performed with 5 min initial denaturation at 96°C followed by denaturation at 96°C for 10 sec, annealing at 55°C for 15 sec, and elongation at 60°C for 4 min for 25 cycles before handing in the samples at the Cologne Center for Genomics (CCG) for analysis. Cleaning was performed by the facility. Data analysis was performed with Chromas lite software.

Site‐directed mutagenesis primer for pGL3‐Enhancer‐198/+88 bp hOAT1.

Bold and underscored nucleotides indicate mutations. F, forward; R, reverse;