Quantification of total HIV DNA in TCM cells.

DNA was extracted from pellets using the DNeasy blood and tissue kit (Qiagen, Hilden, Germany). HIV-1 DNA was quantified by qPCR, using a 5′ nuclease assay for the LTR gene as described previously (65). Briefly, 1 μg DNA was amplified with the sense primer NEC152 (GCCTCAATAAAGCTTGCCTTGA) and the reverse primer NEC131 (GGCGCCACTGCTAGAGATTTT) in the presence of a dually (6-carboxyfluorescein [FAM] and 6-carboxytetramethylrhodamine [TAMRA]) labeled NEC LTR probe (AAGTAGTGTGTGCCCGTCTGTTRTKTGACT). The first PCR cycle allowing fluorescence detection permitted us to quantify HIV-1 DNA by the level of expression relative to that of the endogenous control (β-globin). All samples were tested in the same assay, and results were expressed as the percentage of HIV DNA expression relative to that of the unstimulated control, set at 100%.