The harmonized gene sequences with flanking NdeI and XhoI restriction enzyme sites were synthesized and cloned into the pUC57 cloning vector (Genewiz). The synthesized genes were excised from pUC57 vector through NdeI and XhoI resitriction sites. The excised DNA fragments were ligated into the pAVE029 expression vector (MSD Biologics UK) using T4 DNA ligase (Promega) for 4 h at 16 °C. Ligated plasmids were transformed into competent cells DH5α (Invitrogen) and grown on LB agar plates with 10 μg/mL tetracycline. Colonies harboring the recombinant plasmid were identified by PCR and confirmed by sequencing using pAVE029 vector specific primers for 5′end of the gene (ppop40 primer ATTCTGCATTCACTGGCCGAGG) and 3′end of the gene (T7 Term standard sequencing primer GCTAGTTATTGCTCAGCGG). The sequence-confirmed positive colonies were propagated in LB medium with 10 μg/mL of tetracycline and plasmid DNA was isolated from the cell cultures with HiSpeed Maxi Kit (Qiagen).
The recombinant plasmid DNA was transformed by electroporation into an expression host strain E. coli K12 W25113 using a Bio-Rad GenePulser. Transformed cells were plated on LB Agar plates with 10 μg/mL tetracycline and grown overnight at 37 °C. Single colonies were picked and inoculated into Cinnabar media (Teknova) with 10 μg/mL of tetracycline and grown at 37 °C with shaking at 250 rpm until OD600 reaches to mid log phase (~0.5). 0.4 mM IPTG was added into the cell culture for induction and the cell culture was incubated for 4 h at 30 °C with shaking. The cell cultures were then characterized by whole cell flow cytometry antibody binding, SDS-PAGE, and western blot analyses.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.