Construction of ccN CopyCat element

Cloning of the ccN CopyCat plasmid followed the same strategy as described in Xu et al.⁷ using homology arms to the yellow locus abutting gRNA-y1 cleavage site and carrying gRNA-y1, gRNA-N+, and a 3XP3-DsRed eye marker as depicted in Supplementary Fig. ¹ (the full DNA sequence of this plasmid is provided in Supplementary Table ¹). Following assembly of its components, the ccN CopyCat plasmid was transformed into One Shot® TOP10 competent cells (Invitrogen #C4040) and purified using the Qiagen Plasmid Midi Kit (#12191). An injection mix containing the ccN plasmid (final concentration: 250 ng/µl) was sent to Best Gene Inc. for injection into embryos collected from a w^a N^Ax16 rb⁻ stock (which is resistant to the otherwise lethal mutagenesis of the Notch locus generated by Cas9/gRNA-N+) with a transient source of pHsp70-Cas9 (Addgene plasmid #45945). The w^a N^Ax16 rb⁻ stock was kindly provided by Jim Posakony (UCSD). Male transformants carrying the ccN element were identified in F1 progeny by virtue of their yellow⁻ and DsRed fluorescent eye-marker phenotypes. This genomic insertional allele is referred to as: y^{<CC|gRNA-y1, gRNA-N+|3XP3DsRed>} in accordance with our previously established nomenclature convention^6,7 (see Supplementary Fig. ¹ for details of the construct). For shorthand in the text, we refer to this allele as: y^<ccN>. The ccN plasmid construct was fully sequenced prior to injection as well as that of the ccN genomic insertion for several individual y^<ccN> transformant lines, which included PCR amplification and sequencing of endogenous sequences lying adjacent to those included as homology arm templates in the plasmid construct to verify accurate insertion of the ccN element into the intended site (Supplementary Table ¹).

Genomic DNA from single adult flies were prepared according to protocols by Gloor et al.³³. Single flies were crushed in lysis buffer (10 mM Tris pH8.2, 1 mM EDTA, 25 mM NaCl, with 0.3 mg/ml Proteinase K, added right before incubation), incubated at 37 °C for 30 min, and heated at 95 °C for 2 min. One hundred μl of ddH₂O were added to each tube before storage at −20 °C.

Flies carrying the donor y^<ccN> w^a N^Ax16 chromosome were identifiable through the visible w^a orange eye phenotype. y^<ccN> w^a N^Ax16/FM7 females were crossed to vasaCas9 homozygous males (BL# 51324) to generate F1 master females as diagrammed in Fig. 1d. Crosses were performed at 25 °C on standard Drosophila food. The y⁻ w⁺ N^AxE2 line carrying a gRNA-N+-sensitive Abruptex allele was kindly provided by Spyros Artavanis-Tsakonas (Harvard University). A cleavage-insensitive N⁺ allele recovered among the 104 isogenic lines was recombined with y^<ccN> w^a to generate the donor chromosome in Fig. 4b. For quantitative analyses of F2 progeny (or F3 progeny for the shadow-drive), 20–37 crosses consisting of 3 females mated to 3 males were analyzed for each experiment, yielding an average of ~150 flies per cross. A total of 29,000 progeny were analyzed for this study.

To sequence mutations in the yellow locus, an ~500-bp fragment was amplified by PCR (Q5 Hot Start High-Fidelity 2× Master Mix) with primers 417 (TTTAGTGCCTCAATAATAGTTTGGCCCTGC) and 356 (GGACATACCAAATATACCCTCC), then sequenced with primer 418 (GGAAGTTAATACCAGCGACATTGAAATCGC) at Genewiz. To identify donor vs. receiver chromosomes, a fragment from Notch intron 5 was amplified with primers NintS3 (CTACGAGTGCAAGTGCCCCAAAG) and NintAS3 (CGCCCGGAACGTTGGAATGGAATG) and sequenced with NintS3bis (CAGTAGGAACCAGATTAATCGAGTT). For sequencing mutations in the N^Ax region, primers NAxS (CCACGAGCAAAACAACGAGTACAC) and NAxAS2 (TTCGAATCACAATCCTGACCACTCAGC) were used to amplify an ~1-Kb fragment and sequenced using primer NAxS3 (GCATCAATGGCTACAACTGTAGC).

All crosses using active genetics were performed in accordance to an Institutional Biosafety Committee-approved protocol from UCSD in which full gene-drive experiments are performed in a high-security ACL2 barrier facility and split drive experiments are performed in an ACL1 insectary in plastic vials that are autoclaved prior to being discarded in accord with currently suggested guidelines for laboratory confinement of gene-drive systems^34,35.

Drosophila wings were dissected in isopropanol and mounted in 100% Canada balsam.

Fixation and antibody staining of embryos using a rat anti-Elav (DSHB# 7E8A10, antibody dilution = 1/20) was performed according to standard procedures. Samples were mounted in Slowfade diamond anti-fade mountant (Thermo Fisher Scientific #{"type":"entrez-protein","attrs":{"text":"S36963","term_id":"480490","term_text":"pir||S36963"}}S36963) and imaged on a Leica SP5 confocal microscope. Each data point in Fig. 2c corresponds to the analysis of a group of 30–50 embryos on a slide. Embryos of stages 11–16 were scored for N⁺/N⁻ phenotypes using a Zeiss AXIO ZOOM V16 fluorescent microscope.

We have complied with all relevant ethical regulations for animal testing and research and conformed to the UCSD institutionally approved biological use authorization protocol (BUA #311).