Preparation and construction of recombinant adeno-associated virus (rAAV)

To manipulate the expression of miR-124 in vivo, the rAAV (type 9) was used. The rAAV system (type 9) was a kind gift from Dr. Xiao (University of North Carolina Eshelman School of Pharmacy, Chapel Hill, NC) [50]. For the overexpression of miR-124, oligonucleotides were designed as miR-124 (5′- GATCCGGCATTCACCGC GTGCCTTATTCAAGAGATAAGG CACGCGGTGAATGCCCCGC-3′) according to the mature sequence of hsa-miR-124-3p provided by miRBase (Accession: MIMAT0000422). To achieve the efficient and long-term-suppression of miR-124, tough decoy RNAs (TuDs) were employed as described previously [51, 52]. The oligonucleotides were designed as miR-124 TuDs (5′- GATCCGACGGCGCTAGGATCATCAA CGGCATTCACCATCTGCGTGCCTTACAAGTATTCT GGTCAACAGAATACAACGGCATTCACCATCTGC GTGCCTTACAAGATGATCCTAGCGCCGTCTTCCG C-3′). The oligonucleotides and their reverse complements were synthesized by BGI Tech (Shenzhen, China) and were then then annealed and ligated into rAAV vectors. For the expression of CD151, the full-length sequence of its protein coding sequence (CDS) was amplified by PCR using the primers and then ligated into rAAV vectors. The rAAVs were packaged by triple-plasmid co-transfection in HEK293 cells and were purified as described previously [53]. The resultant rAAVs were designated as rAAV-miR-124, rAAV-miR-124 TuDs, and rAAV-CD151, respectively.