RNA Extraction, RT-PCR, and Real-Time Quantitative PCR

For measurement of Hsd11b1 and 2, RNA was extracted from fetal placenta and brain using peqGOLD TriFast™, according to the manufacturer's instruction (VWR International GmbH, Darmstadt, Germany). RNA concentration was quantified via NanoDrop ND1000 spectrophotometry (Peqlab) and adjusted to 1 ng/ml. After DNase treatment, RNA was transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) and random hexamers as primers. Reactions without Quantiscript Reverse Transcriptase served as negative controls. Quantitative real-time PCR was performed with SYBR Green (Applied Biosystems, Darmstadt, Germany; ThermoFisher Scientific) using the StepOnePlus Real-Time PCR System (Applied Biosystems). Samples were run in duplicates and mRNA levels were normalized to the housekeeping gene 18S rRNA. SYBR-Green based real-time PCR results were compared between groups using the 2^−ΔΔCT-method. Primers sequences were as following (5′-3′): r18s forward (fw) TTGATTAAGTCCCTGCCCTTTGT, r18s reverse (rev) CGATCCGAGGGCCTCACTA; Hsd11b1 fw TAGACACAGAAACAGCTTTG, Hsd11b1 rev AATTCCATGATCCTCCTTCC; Hsd11b2 fw CAGGAGACATGCCATACC, Hsd11b2 rev GATGATGCTGACCTTGATAC.

Sex verification was carried out via sex-determining region Y (Sry) gene PCR (45). DNA from tail-tip biopsies was extracted using the MyTaq™ Extract-PCR Kit (Bioline, London, UK). Sex determination was performed via commercially available PCR Sry assay (Rn04224592; ThermoScientific, Waltham, USA) with 18S rRNA as housekeeping gene. PCR conditions were adopted from the manufacturer's protocol (ThermoFisher). For male gender a cut-off <23 cycles was chosen, while the threshold for female sex was >29 cycles. When verification was needed, we repeated the measurement with corresponding liver samples.