shRNA transfection

The short hairpin RNA (shRNA) plasmid used in the IGF-1R RNAi knockdown experiments was described previously [21]. The forward DNA template was gatccccgaagatttcacagtcaacttcctgtcagattgactgtgaaatcttcggtttttg, and the reverse DNA template was aattcaaaaaccgaagatttcacagtcaatctgacaggaagttgactgtgaaatcttcggg. IGF-1R shRNA or shRNA vectors were transfected following the protocol of Lipofectamine 2000 (Invitrogen, Shanghai, China). Briefly, shRNA and Lipofectamine 2000 were diluted in Opti-MEM (Invitrogen, Shanghai, China) and then combined for 20 min at room temperature to allow for the formation of transfection complexes. Complexes were added to cells for 6–8 h at 37 °C. The medium was exchanged with fresh growth medium, and cells were grown for another 72 h in culture before being used for experiments.