Sequencing of Fungal ITS2 Gene Region and Pre-processing

Internal Transcribed Spacer (ITS) 2 region of fungi was targeted for taxonomic profiling by amplification using ITS2F (GCATCGATGAAGAACGCAGC) and ITS2R (TCCTCCGCTTATTGATATGC) primers (Blaalid et al., 2013) due to its high interspecific variability which also conserved primer sites with multiple copies (Schoch et al., 2012). A composite sample for sequencing was made by combining equimolar ratios of amplicons from the samples, followed by gel purification with a QiagenMinElute gel extraction kit to remove potential contaminants and PCR artifacts. Amplicon libraries were purified by 1X AMpureXP beads, which were checked on an Agilent DNA 1000 chip on Bioanalyzer 2100, and finally quantified by Qubit Fluorometer 2.0 using Qubit dsDNA HS Assay kit (Life Technologies). MiSeqIllumina platform using 2 × 250 bp chemistry sequencing was performed. Pre-processing of downstream analysis for raw read was completed as described by Comeau et al. (2017), as follows: firstly, raw read quality from sequencer was checked for the average and range of the Phred quality scores along the reads (1 to 300 bp), for both forward and reverse reads independently, to pass it to the next steps using FastQC²; secondly, removal of adapter sequences through cut adapt tool (Martin, 2011); thirdly, adapter cleaned paired-end reads files merged using the PEAR (v0.9.10) program (Zhang et al., 2014) with default settings; fourthly, FASTQ stitched files were converted to FASTA and removed any sequences that had an “N” in them with run_fastq_to_fasta.pl command lin; and lastly, chimeric sequences were removed with VSEARCH tool (Rognes et al., 2016) using UNITE_uchime_ITS2only_01.01.2016.fasta reference dataset.