Construction of lentiviral vectors and administration

YZ Yi Zhang
PS Peiying Shan
AS Anup Srivastava
ZL Zhenyu Li
PL Patty J. Lee
request Request a Protocol
ask Ask a question
Favorite

Lentivirus miRNA vectors with ubiquitin and vascular endothelium cadherin promoter had been described previously (42). STC1-knockdown vectors were designed using target site 1452–1473 (GenBank accession number NM_009285.3) 5′-ATTAGATGCAAGAAGATGCTAG-3′. We used Thermo Fisher Scientific, Inc., Scientific–Invitrogen's online RNAi Designer tool to design pre-miRNA stem loop/siRNA hybrid sequences according to the manufacturer's instructions. Two oligos, 5′-TGCTGATTAGATGCAAGAAGATGCTAGTTTTGGCCACTGACTGACTAGCATCTTTGCATCTAAT -3′ and 5′-CCTGATTAGATGCAAAGATGCTAGTCAGTCAGTGGCCAAAACTAGCATCTTCTTGCATCTAATC-3′, were annealed and ligated into pcDNA6.2-GW/EGFP-miR (K493600; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions.

The constructs were confirmed by sequencing. The lentiviral constructs of EGFP-STC1-RNAi were constructed by first amplifying the fragments from pcDNA6.2-GW/EGFP-miR with primers, sense: 5′-AGGCGCGCCTGGCTAACTAGAGAAC-3′ and antisense: 5′-GGAATTCTATCTCGAGTGCGGC-3′, and by digestion of the PCR product with AscI and EcoRI enzymes. This fragment was then inserted into the AscI and EcoRI sites of vectors FVEW or FUW (42) to generate lenti-VE STC1sh or lenti-STC1sh vectors. TLR4-knockdown vectors (lenti-TLR4sh and lenti-VE TLR4sh) were constructed using similar strategy and were designed using target site 550–570 (GenBank accession number NM_021297.2) 5′-GTACATGTGGATCTTTCTTAT-3′ (33).

Lentiviral STC1 overexpression (lenti-STC1oe or lenti-VE STC1oe) was constructed by amplifying the fragments from pCMV6 entry STC1 construct (STC1, [NM_009285] Mouse ORF Clone, MR203105, Origene, Rockville, MD) with primers, sense: 5′-AGGCGCGCCAATTCGTCGACTGGAT-3′ and antisense: 5′-GGAATTCGTTTAAACCTTATCGTCGT-3′. The STC1 was recovered from the PCR fragment by AscI and EcoRI digestion and then inserted into the AscI and EcoRI sites of FVEW to generate lenti-VE STC1oe, or of FUW to generate lenti-STC1oe. All restriction endonucleases were purchased from New England Biolabs (Ipswich, MA). Lentivirus production, titer measurement, and intranasal administration were previously described (42). In lentivirus delivery experiments, 1 × 108 transduction units of the package lentiviral particles were administered intranasally to 6- to 8-week-old mice through a published intranasal method (42).

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A