request Request a Protocol
ask Ask a question
Favorite

The plasmids for the expression of the recombinant proteins EIII, HSP70, and chimeric HSP70/EIII protein were constructed using the pET-40b(+) vector (Novagen, Gibbstown, NJ, USA). For the amplification of the Y. pseudotuberculosis HSP70 gene, the chromosomal DNA of the Y. pseudotuberculosis strain 488, Encyclo Taq polymerase (Evrogen, Moscow, Russia), the gene-specific upstream primer dnaK-X-Nco-dir: 5′-ATATCCA TGGCGATGGGTAAAATTATTGGTATCGAC-3′, and the downstream primer dnaK-X-Sac-rev: 5′-TATAGAGCTCGCTTTTTTGTCTTTTACTTCTTCGAATTC-3′ were used. The recombinant plasmid 40HSP70 was obtained by ligation of the HSP70 gene into the pET-40b(+) at the restriction sites of NcoI and SacI. The resultant 40HSP70 plasmid was used for the expression of the HSP70 protein and was also used for the subsequent cloning of the EIII protein.

For the EIII gene amplification, cDNA of TBEV strain Dalnegorsk, Encyclo Taq polymerase, the upstream primer including the flexible linker (G4S)3 E3-X-Sac-L-dir: 5′-TATAGAGCTCGGGTGGT GGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTCTTACATACACAATGTGCGACAAGACGAAATTCAC-3′, and the downstream primer, E3-X-Sal-stop-rev: 5′-TATAGTCGACTT AGTTAAAGGCACCGCCAAGAACTGT-3′ were used. The TBEV cDNA was kindly provided by the Institute of Epidemology and Microbiology, Vladivostok, Russia [13].

The plasmids 40HSP70/EIII and 40/EIII were obtained by ligation of the EIII gene into 40HSP70 and pET-40b(+), respectively, at the restriction sites of SacI and SalI. The resultant 40HSP70/EIII and 40/EIII plasmids were used for the expression of chimeric HSP70/EIII protein and the recombinant domain III of TBEV protein E. Since the EIII protein was not expressed separately due to its high toxicity for Escherichia coli cells, we used the EIII protein obtained using the cell-free continuous exchange system, as described previously [8]. All used primers are shown in Table 1.

Primers and their sequences.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A