2.10. Quantification of mRNA Expression by RT-qPCR

Changes in BAX, BCL2, BIRC5, and CASP8 mRNA expression by HL-60 cells were evaluated using RT-qPCR after treatment with 50 μM majoranolide for 24 and 48 h. In a 6-well plate, 5 × 10⁵ cells were plated per well. After treatment, total RNA was extracted using a ReliaPrep RNA Cell Miniprep System kit (Promega), following manufacturer's instructions. RNA integrity was evaluated in 1% agarose gel. cDNA synthesis was performed using 1 μg of total RNA and Oligo (dT)₁₅ primer, employing a GoScript Reverse Transcription System kit (Promega), according to manufacturer's instructions. After synthesis, a 50 ng amount of cDNA was used for qPCR, together with SsoAdvanced Universal SYBR Green fluorophore (Bio-Rad). The reactions were carried out on a CFX96 Touch Real-Time thermal cycler (Bio-Rad) under the following thermocycling conditions: initial denaturation at 95°C for 30 s, 40 denaturation cycles at 95°C for 15 s, annealing at 62°C for 30 s, and extension at 72°C for 45 s. NTC and NRT controls confirmed the absence of contamination. Melt curve analysis confirmed the absence of nonspecific amplifications. Serial dilutions were performed to obtain the standard curve and efficiency values of primers for the genes investigated. The following primer sequences were employed: BAX forward: CGAGTGGCAGCTGACATGT, reverse: CAGCCCATGATGGTTCTG; BCL2 forward: TGGTGGAGGAGCTCTTCAG, reverse: TCAGGTACTCAGTCATCCAC; CASP8 forward: TGACCACGACCTTTGAAGAG, reverse: GAGAGGATACAGCAGATGAA; BIRC5 forward: CTAAGTTGGAGTGGAGTCTG, reverse: GGCTTGCTGGTCTCTTCTG; β-ACTIN forward: ACCCACACTGTGCCCATCTA, reverse: GGCAATGAGCGGTTCCG. Relative mRNA expression normalized to the β-actin gene was quantified using CFX Manager 3.1 software (Bio-Rad).