The stool sample was diluted to approximately 10% with phosphate-buffered saline. This suspension was vortexed and then centrifuged at 3,000 × g for 10 min. RNA was extracted from 250 μl of the clarified supernatant using 750 μl of TRIzol LS (Life Technologies), as recommended. RNA was then extracted using a QIAamp Viral RNA Mini kit (Qiagen). cDNA was made using 10 μl of RNA and a Superscript II RT kit (Invitrogen) as recommended. The cDNA was digested with 0.01 μg of RNase (DNase free; Roche) and then purified with a QIAquick PCR purification kit (Qiagen) and amplified by PCR using primers targeting the 5-prime (VEE-NV5ʹ, AGTCTAGTCCGCCAAGATGAAGATGGCGTCGAATGAC) and 3-prime (NV3ʹAscI, NNNNNNGGCGCGCCTTATAATGCACGTCTACGCCC) ends of ORF2. The amplicons were cloned into Tope XL (Invitrogen), and 12 colonies were selected and sequenced. GII.4 MC4 represents the consensus sequence of the 12 clones, and MC12 represents the strain with the most divergent sequence. Capsid genes were synthesized by Bio-Basic, Inc. (Amherst, NY). VLPs were expressed in baby hamster kidney cells (ATCC CCL-10) from Venezuelan equine encephalitis virus replicons expressing norovirus open reading frame 2 (NoV ORF2), as described previously (17, 35, 36). Particle integrity was confirmed by electron microscopy visualization of negative-stained particles of ∼40 nm.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.