4.48. Rabbit reticulocyte lysate in vitro translation assays

FS Fadi Soukarieh
MN Matthew W. Nowicki
AB Amandine Bastide
TP Tuija Pöyry
CJ Carolyn Jones
KD Kate Dudek
GP Geetanjali Patwardhan
FM François Meullenet
NO Neil J. Oldham
MW Malcolm D. Walkinshaw
AW Anne E. Willis
PF Peter M. Fischer
ask Ask a question
Favorite

PCR (hot KOD polymerase kit, Novagen®; Qiaquick PCR purification kit, QIAGEN) was used to amplify the luciferase DNA sequence from a pGl3 vector with the primers GCGGCCGGCCGCCCCGACTCTAGAA and GGGGTAATACGACTCACTATAGGGTCC-ACCTCGAATCACTAGTCAGCTG. Alternatively, the plasmid pRHCVF, which contains Renilla luciferase as the upstream cistron and firefly luciferase as the downstream cistron preceded by the HCV IRES, was digested with HpaI and use to prime in vitro transcription reactions. In vitro RNA synthesis was performed on the resulting DNA using a mMessage mMachine® T7 kit (Ambion). The resulting capped RNAs were purified using microSpin G-50 columns (GE Healthcare), analysed by agarose gel electrophoresis, and were stored in aliquots at −80 °C. An in-vitro translation Rabbit Reticulocyte Lysate System kit (Promega) was used as per the manufacturer's instructions. Briefly, 20 ng capped RNA was incubated with rabbit reticulocyte lysate in a final reaction volume of 20 μL. The mixture was incubated at 30 °C for 90 min and then placed on ice for immediate analysis. Diluent (H2O) was replaced by test compound solutions in the course of compound screening and the final DMSO concentration was limited to 1%. Assays were performed with m7GTP as a positive control and a DMSO negative control (which was assigned a 100% value).

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A