Plasmids, lentiviral vectors and stable cell lines

Full-length human FBXO22 cDNA was amplified by PCR and subcloned into the lentiviral vector pBABE-puro (plasmid # 1764; Addgene, Cambridge, MA, USA) to establish LM3 and Hep3B cell lines that stably overexpress FBXO22. The target sequences corresponding to FBXO22 were used to establish stable HLF and HepG2 FBXO22 knockdown cell lines. In addition, the target sequences corresponding to p21 (shRNA: GATGGAACTTCGACTTTGT) were subcloned into the lentiviral vector GV152 (vector containing a neomycin resistance gene; Genechem Co. Ltd., Shanghai, China) to establish stable HLF and HepG2 cell lines with FBXO22 knocked down.

Briefly, DNA fragments (FBXO22 shRNA#1 CAAGTAGTCAGCACTTTCA, FBXO22 shRNA#2 GGAATTGTAGTGACTCCAATG) were subcloned into the lentiviral vector pLKO.1 puro (plasmid # 10787; Addgene). The plasmids pMD2.G and psPAX2 were gifts from Didier Trono (plasmids # 12259 and #12260; Addgene). For plasmid transfection, 293 T cells were plated in 6-cm dishes and co-transfected with target plasmids (1 μg) and virus packaging plasmids (pMD2.G 0.25 μg, psPAX2 0.75 μg) using Lipofectamine2000 (Invitrogen, USA) or Xtreme HP (Roche, Basel, Switzerland). Eight hours after transfection, cells were transferred to fresh medium-containing 10% FBS and incubated for 48-72 h. The lentivirus-containing supernatants were collected, passed through a 0.45 μm filter (PALL, Port Washington, NY, USA), and used for infection of the cells. The HCC cells were transfected with the lentivirus in the presence of polybrene (8 μg/ml; Sigma, St Louis, MO, USA). At 48 h after infection, the cells were selected using growth medium containing 5 μg/ml puromycin for 7 days or 400 μg/ml G418 for 14 days. GV152 transfection of the indicated HCC cell lines followed the manufacturer’s instructions. The efficiency of overexpression and knockdown was verified by RT-PCR or western blot analysis.