Quantitative reverse transcription polymerase chain reaction

Total RNA was isolated using TRIzol (Invitrogen). One microgram of total RNA was used for the first‐strand complementary DNA synthesis (Amersham Biosciences), which was then used for SYBR Green–based quantitative reverse transcription polymerase chain reaction (RT‐PCR) in triplicate according to the manufacturer's instructions. Gene expression was normalized to the housekeeping gene β‐actin. Specific primers: cathepsin K: Fwd 5’‐ATATGTGGGCCAGGATGAAAGTT‐3’; Rev 5’‐TCGTTCCCCACAGGAATCTCT‐3’, c‐fms: Fwd 5’‐ATGTCAAAGATCCGGCCCAC‐3’; Rev 5’‐GGTCAGTGATCAGACAGGGC‐3’, RANK: Fwd 5'TGGAACTCAGACTGCGAGTG‐3’; Rev 5’‐CCTTGTTGAGCTGCAAGGGA‐3’, β‐actin: Fwd 5‐TGTCCACCTTCCAGCAGATGT‐3’; Rev 5’‐AGCTCAGTAAC‐AGTCCGCCTAGA‐3’.