Small interfering RNA transfection

Small interfering RNAs (siRNA) were obtained from Invitrogen (Carlsbad, CA, USA). The following siRNAs were used: siTRAIL #1 (10620318-241607 D09; Stealth RNAi™ siRNA), ACCUGCGUGCUGAUCGUGAUCUUCA; siTRAIL #2 (10620318-242264 E05; Stealth RNAi™ siRNA), AAUCAUCAAGGAGUGGGCAUUCAUU; and a negative control (12935-112; Stealth RNAi™ siRNA negative control Med GC duplex #2). Cells were seeded at a density of 5×10⁴ cells per well in 6-well plates. After incubating for 24 h, cells were transfected using lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. Twenty-four hours after the transfection, the cells were treated with agents for 72 h and then harvested.