Cloning of OsPCS genes

A fragment of OsPCS5 cDNA was amplified by PCR using the gene‐specific primers 5′‐CTCGAGATGGCAGCGATGGCATCCCTG‐3′ and 5′‐TACTAGTCCACCTCCATGGGATTGTGGCACAGGATC‐3′, which contained XhoI and SpeI sites, respectively. In addition, OsPCS15 cDNA was amplified using the gene‐specific primers 5′‐CTCGAGATGGCGTCTAAACCAAGCAGCCGAGCGGAA‐3′ and 5′‐TACTAGTCCACCTCCGCATTGTTCCCAAGGTTGTGG‐3′, which contained XhoI and SpeI sites, respectively. The genes were then cloned into the pGEM‐T easy vector (Promega, Madison, WI, USA) and used for various plasmid constructs.