Reverse transcriptase PCR

Cell and EV samples from the tumor microenvironment were collected as described above. RNA isolation was performed on cell and EVs previously stored in Trizol at −80°C. RNA isolation was performed according to the manufacturer's instructions with addition of 5 μl glycogen to the aqueous phase (Roche, 10901393001). RNA pellet was taken up in RNase‐free water. cDNA was prepared using the High‐Capacity cDNA Reverse Transcription kit (Applied Biosystems 4368814) according to the manufacturer's instructions. cDNA was amplified using primers for Cre (Forward primer 5′ GCCTGCATTACCGGTCGATGC 3′; Reverse primer 5′ GTGGCAGATGGCGCGGCAACA 3′) and RPL38 (Forward primer 5′ AGGATGCCAAGTCTGTCAAGA 3′; reverse primer 5′ TCCTTGTTGTGATAACCAGGG 3′) using the thermal cycles 5 min at 95°C, 35 cycles of 95°C for 30 s, 58°C for 30 s, 72°C for 1 min, and after the last cycle a final extension of 10 min at 72°C. PCR products were visualized on a 2% TAE agarose gel.