Generation of shRNA resistant Spp1 plasmids for rescue experiments

In order to generate shRNA resistant constructs coding for a wild type and a ΔC-term pSpp1 (lacking a CD44 domain of Spp1), we performed a site-directed mutagenesis. We designed mismatched oligonucleotides binding to Spp1 shRNA binding site: Spp_mut_R: CTTCCTTACTCTTTGGATCGA GTACTAGTTTGTCC TCATGGCTGTG and Spp_mut_F: CCATGAGGACAAA CTAGTACT CGATCCAAAGAGTAAGGAAGATGAT AG. Primer-extension reaction amplified pEGFP-N1 vector carrying a wild type Spp1 cDNA (wtSpp1) or Spp1ΔC cDNA. The PCR reaction was performed with Phusion polymerase (New England Biolobs) using reaction conditions recommended by the manufacturer. Primer annealing was performed in 60°C. In order to eliminate template DNA, PCR product was digested with DpnI restriction enzyme and further transformed into XL1-Blue E.coli strain. Designed mutagenesis introduced point mutations without affecting aminoacid sequence and in the same time generated a new restriction site for SpeI enzyme. Simultaneous digestion with SpeI (Thermo Scientific) and EcoRI (Thermo Scientific) helped us to preselect proper clones before sequencing. The resulting plasmids were verified by sequencing.