2.9. VDR Silencing

To silence VDR expression in hepatocellular carcinoma cells, five lentiviral vectors expressing diverse shRNA with the gene for puromycin selection, were utilized (505; NM000376.1-923s1c1: 506; NM000376.1-578s1c1: 542; NM000376.1-623s21c1: 543; NM000376.1-1878s21c1: 544; NM000376.1-885s21c1; Sigma). Lentiviral vectors (EB8, EB10) generated inhouse with the promoter for phosphoglycerate kinase (PGK) driving green fluorescent protein (GFP) and puromycin genes, were used as controls. Lentiviral (LV) vectors were generated and expanded [36], with each viral vector tested in both HUH7 and HepG2 cells to optimize transduction and puromycin selection-efficiency. A total of 1 × 10⁵ cells/6 well plate, were infected with a 1/10 dilution of each lentiviral vector for 48 h, at which time the cells were selected using increasing concentrations of puromycin (1–10 ug/ml; Sigma). The LV transduction was assessed by GFP expression in control cells using fluorescence-activated cell sorting (FACS; FACSCalibur BF-FACS3, BD Biosciences, San Jose, CA), with integration assessed by PCR of gDNA using the following primer pairs (shRNA 505 and 506: foward 5′- CAACCTCCCCTTCTACGAGC-3′ and reverse 5′- GGCTAAGATCTACAGCTGCCTTG – 3′: shRNA 542, 543, 544, EB8 and EB10: foward 5′- TTGCTTCCCGTATGGCTTTC-3′ and reverse 5′- GGCTAAGATCTACAGCTGCCTTG – 3′ GAPDH; foward 5′- AACGTGTCAGTGGTGGACCTG-3′and reverse 5′- AGTGGGTGTCGCTGTTGAAGT-3′). All experiments were subsequently performed in HepG2 cells under puromycin selection at 3 mg/ml. Where described, the shVDR HepG2 clones (505, 506, 542, 543 and 544), EB8 and EB10 controls, and HepG2 cells were plated 0.3 × 10⁶ cells/6 well plate and were left to reach 90% confluency, at which time cell lysates were prepared for western immunoblot analysis. Likewise, for the inhibition of endocytosis, the shVDR HepG2 clones (505, 506, 542, 544), EB8 control and HepG2 cells were plated 0.5 × 10⁵ cells/12 well plate in maintenance medium. At 60% confluency, they were treated dose dependently with 1–10 ug/ml of Filipin (Sigma), or 5–10 ug/ml of chlorpromazine hydrochloride (CPZH) with the appropriate excipient for 1hr in serum free medium to block endocytosis. Following 1hr, the inhibitors were replaced with growth medium for a further 24 h, at which time cell lysates were prepared for the analysis of FETUB by western immunoblot.