The isolation of total RNA from the skin tissue of different experimental groups (50 mg) was performed according to the manufacturer protocol of the RNeasyR tissue mini kit (Qiagen). Both the quality and amount of the extracted total RNA were checked using a NanoDrop 1000 Spectrophotometer. The cDNA was synthesized using the first-strand cDNA synthesis kit (Fermentas, Life Sciences). The cDNA was then used in the real-time PCR step that was performed using BioEasy SYBR Green I Real-Time PCR Kit. PCR amplification consisted of 45 s at 94 °C, 45 s at 59 °C, and 45 s at 72 °C for 40 cycles. Transcript levels were normalized to those of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) the primer sequence for GAPDH was used as reported by Morgan et al37. Collagen type I gene forward and reverse primer were F AACAAGGGAGGAGAGAGTGC; R AGTCTCTTGCTTCCTCCCAC. PCR specificity was verified by melting curve analysis. All samples were analyzed in duplicate, and relative gene expression was calculated by the 2−ΔΔCt method.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.