The mouse myoblast cell line, C2C12, was grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum at 37 °C and 5% CO2 for 24 h before transfection as previously descried [5]. Cells were transfected with 50 nM Stealth RNAi (Thermo Fisher Scientific, MA, USA) using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer's protocol; stealth RNAi was used as a negative control (Thermo Fisher Scientific, Med GC duplex) while myogenin (Thermo Fisher Scientific, MSS275912) and hnRNPK (Thermo Fisher Scientific, MSS205172) were the tests. The target sequence of Stealth RNAi for Myoparr is as follows; 5′- GATGGACCCTGTCTGATGCTCTTAA -3'. The target sequence of Stealth RNAi for Ddx17 was previously described [6] and is as follows; 5′- CACCAACAAGGGCACTGCCTATACT -3'. Twenty-four hours after siRNA transfection, C2C12 cells were induced for myogenic differentiation by replacing the medium with DMEM supplemented with 2% horse serum. Twenty-four hours after induction of differentiation, total RNA was isolated from the cells using ISOGEN II regent (Wako, Japan) according to the manufacturer's protocol.
The intact Poly(A)+ RNA was isolated from 1 μg of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, MA, USA) and used for RNA-seq library construction using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer's protocol.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.