2.7. Quantitative Real-Time PCR

Total RNA was extracted from myocardial tissue using a TRIzol reagent (Invitrogen, Carlsbad, CA), and DNase-treated RNA was reverse transcribed with the use of a Transcriptor First-Strand cDNA Synthesis Kit (Roche, Indianapolis, IN). Quantitative real-time PCR analysis was done in triplicate using the FastStart Universal SYBR Green Master (Roche). PCR primers were synthesized from Sangon Biotech Co. Ltd. (Shanghai, China) as follows: for superoxide dismutase (SOD), AGATGACTTGGGCAAAGGTG and CAATCCCAATCACACCACAA; for nuclear factor (erythroid-derived 2)-like 2 (Nrf2), TTCCTCTGCTGCCATTAGTCAGTC and GCTCTTCCATTTCCGAGTCACTG; for heme oxygenase-1 (HO-1), CACGCATATACCCGCTACCT and CCAGAGTGTTCATTCGAGCA; for catalases (CAT), ACATGGTCTGGGACTTCTGG and CCATTCGCATTAACCAGCTT; for Kelch-like ECH-associated protein 1 (Keap-1), AGCAGATCGGCTGCACTGAA and AGCTGGCAGTGTGACAGGTTG; for musculoaponeurotic fibrosarcoma (Maf), AAGGAGGAGGTGATCCGACT and TCGAGCAGTTTTCTCGGAAC; and for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ATGATTCTACCCACGGCAAG and CTGGAAGATGGTGATGGGTT. Among them, GAPDH was employed as a housekeeping gene. Relative mRNA expression levels were calculated by the 2^−ΔΔCt method.