In vitro transcription of RNA Bind-n-seq (RBNS) random input RNA

RBNS random input RNA was prepared by in vitro transcription using the RBNS T7 template (5′-ACACTC TTTCCCTACACGACGCTCTTCCGATCT(N)₄₀GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTATAGTGAGTCGTATTA-3′), a DNA oligo containing a random 40mer sequence flanked by priming sites for the addition of Illumina adaptors and the T7 promoter sequence. To artificially create a double-stranded T7 promoter, a T7 oligo (5′-TAATACGACTCACTATAGGG-3′) was annealed to the region of the RBNS T7 template corresponding to the T7 promoter sequence by heating the template and T7 oligo in equal proportions up to 95°C and cooling down at a rate of 0.1°C/s to 45°C. The RBNS input RNA pool was then in vitro transcribed using the HiScribe T7 in vitro transcription kit (NEB). The produced RNA was then bead purified using AMPure XP RNase free beads (Beckman Coulter Inc.).