Quantification of plasma EBV DNA

Measurement of plasma EBV DNA was performed at baseline (pre‐EBV) and at the midpoint of radiotherapy (mid‐EBV), end of therapy (end‐EBV), and 3 months after therapy (3 m‐EBV) using real‐time quantitative PCR. The assay was developed for detection of plasma EBV DNA and targets the BamHI‐W fragment region of the EBV genome ¹⁰ and was performed using 2× TaqMan reagent (Roche), the amplification primers W‐44F (50‐AGTCTCTGCCTCAGGGCA‐30) and W‐119R (50‐ACAGAGGGCCTGTCCACCG‐30), and the dual‐labeled fluorescent probe W‐67T (50‐[FAM]‐CACTGTCTGTAAAGTCCAGCCTCC‐[TAMRA]‐30). At our institution, a plasma EBV DNA concentration of <10³ copies/mL was defined as undetectable. The cutoff values for each time point were defined using ROC curve analyses: The cutoff levels chosen to define low and high EBV DNA were pre‐EBV, 2500 copies/mL; mid‐EBV, 871 copies/mL; end‐EBV, 721 copies/mL; and 3 m‐EBV, 211 copies/mL.